shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(WDR25-shRNA-Seq3)(CAT#: AdV-SI0866WQ)

This product is a WDR25-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The WD domains of WDR25 gene are involved in protein-protein interactions in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The expression of WDR25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert WDR25-shRNA-Seq3
Related Target/Protein WDR25
Region CDS
TargetSeq GAAGTGACTTTAGAATCACTA
NCBI RefSeq NM_024515
Alternative Names C14orf67
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79446
Uniprot ID Q64LD2

Related Products