shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(YPEL3-shRNA-Seq1)(CAT#: AdV-SI0657WQ)

This product is a YPEL3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The YPEL3 gene is involved in proliferation and apoptosis in myeloid precursor cells. The expression of YPEL3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert YPEL3-shRNA-Seq1
Related Target/Protein YPEL3
Region CDS
TargetSeq GATGATTGTCACCGGAGGTAT
NCBI RefSeq NM_031477
Alternative Names Ypel3; Suap
Titer >1*10^10 GC/mL
Related Diseases Mammary tumor
Target Gene
Gene ID 83719
Uniprot ID P61236

Related Products