shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ZDHHC3-shRNA-Seq2)(CAT#: AdV-SI0969WQ)
This product is a ZDHHC3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | ZDHHC3-shRNA-Seq2 |
| Related Target/Protein | ZDHHC3 |
| Region | CDS |
| TargetSeq | GAAGAAGATTGGACAACCTAT |
| NCBI RefSeq | NM_016598 |
| Alternative Names | GODZ; DHHC3; DHHC-3; ZNF373 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast Cancer |
