shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(2700050L05Rik-shRNA-Seq1)(CAT#: AdV-SI2242WQ)
This product is a 2700050L05Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The 2700050L05Rik gene has the ability to positive regulation of transcription. The expression of 2700050L05Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | 2700050L05Rik-shRNA-Seq1 |
Related Target/Protein | 2700050L05Rik |
Region | 3UTR |
TargetSeq | CGGTGCTGAGACTTATTAAAT |
NCBI RefSeq | NM_178115 |
Alternative Names | AU022667; AW558805; Edrf1 |
Titer | >1*10^10 GC/mL |