shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(2700050L05Rik-shRNA-Seq1)(CAT#: AdV-SI2242WQ)

This product is a 2700050L05Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The 2700050L05Rik gene has the ability to positive regulation of transcription. The expression of 2700050L05Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 2700050L05Rik-shRNA-Seq1
Related Target/Protein 2700050L05Rik
Region 3UTR
TargetSeq CGGTGCTGAGACTTATTAAAT
NCBI RefSeq NM_178115
Alternative Names AU022667; AW558805; Edrf1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 214764
Uniprot ID E9Q9F9

Related Products