shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(4930447C04Rik-shRNA-Seq2)(CAT#: AdV-SI1863WQ)

This product is a 4930447C04Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 4930447C04Rik-shRNA-Seq2
Related Target/Protein 4930447C04Rik
Region CDS
TargetSeq GACTCTGGTATGGATAGTAAT
NCBI RefSeq NM_029444
Alternative Names Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 75801
Uniprot ID B2RQE0

Related Products