shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(6030498E09Rik-shRNA-Seq3)(CAT#: AdV-SI1909WQ)
This product is a 6030498E09Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 6030498E09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | 6030498E09Rik-shRNA-Seq3 |
Related Target/Protein | 6030498E09Rik |
Region | CDS |
TargetSeq | GATGATTCTGTGGGATCTATC |
NCBI RefSeq | NM_183126 |
Titer | >1*10^10 GC/mL |