shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(AW209491-shRNA-Seq1)(CAT#: AdV-SI2328WQ)

This product is a AW209491-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of AW209491-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert AW209491-shRNA-Seq1
Related Target/Protein AW209491
Region 3UTR
TargetSeq CCACTTGTCTTAGCTGGGATT
NCBI RefSeq NM_134067
Titer >1*10^10 GC/mL
Target Gene
Gene ID 105351
Uniprot ID A0A1Y7VLG8

Related Products