shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(BC049762-shRNA-Seq1)(CAT#: AdV-SI2230WQ)

This product is a BC049762-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of BC049762-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert BC049762-shRNA-Seq1
Related Target/Protein BC049762
Region CDS
TargetSeq CACTTTCTGTGTACCCTCAAA
NCBI RefSeq NM_177567
Alternative Names 4930503F14
Titer >1*10^10 GC/mL
Target Gene
Gene ID 193286
Uniprot ID A0A338P6D5

Related Products