shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(BTBD9-shRNA-Seq3)(CAT#: AdV-SI0415WQ)

This product is a BTBD9-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert BTBD9-shRNA-Seq3
Related Target/Protein BTBD9
Region CDS
TargetSeq GCAGAAGCATTCACAATGCTA
NCBI RefSeq NM_152733
Alternative Names dJ322I12.1
Titer >1*10^10 GC/mL
Related Diseases Tourette Syndrome
Target Gene
Gene ID 114781
Uniprot ID Q96Q07

Related Products