shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C15orf45-shRNA-Seq1)(CAT#: AdV-SI0356WQ)

Datasheet

This product is a C15orf45-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C15orf45-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C15orf45-shRNA-Seq1
Related Target/Protein C15orf45
Region CDS
TargetSeq GCCAATTCAGCACAGATAGAA
NCBI RefSeq NM_001035530
Titer >1*10^10 GC/mL
Related Diseases Hereditary Colorectal Cancer

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(RNPS1-shRNA-Seq4) (CAT#:AdV-SI1054WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Fbxw16-shRNA-Seq4) (CAT#:AdV-SI2689WQ) Recombinant adenovirus, pU6-(Human VEGF-B 167), Overexpression (CAT#:AdV-GTOH0099WQ) Recombinant adenovirus, pU6-(Human NGF), Overexpression (CAT#:AdV-GTOH0610WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Peo1-shRNA-Seq3) (CAT#:AdV-SI1842WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SUN5-shRNA-Seq2) (CAT#:AdV-SI1073WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR52I1-shRNA-Seq5) (CAT#:AdV-SI1667WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Mettl4-shRNA-Seq3) (CAT#:AdV-SI2698WQ)