shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C1QL4-shRNA-Seq1)(CAT#: AdV-SI0434WQ)
This product is a C1QL4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C1QL4 gene may regulate the number of excitatory synapses that are formed on hippocampus neurons. The expression of C1QL4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C1QL4-shRNA-Seq1 |
| Related Target/Protein | C1QL4 |
| Region | CDS |
| TargetSeq | CCAACAAGTACAGCACCTTCT |
| NCBI RefSeq | NM_001008223 |
| Alternative Names | CTRP11; C1QTNF11 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Coronary artery disease |
