shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C22orf39-shRNA-Seq1)(CAT#: AdV-SI0407WQ)
This product is a C22orf39-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C22orf39-shRNA-Seq1 |
| Related Target/Protein | C22orf39 |
| Region | 3UTR |
| TargetSeq | GCGATGTTCTGCAGGACAATT |
| NCBI RefSeq | NM_173793 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Liver cancer |