shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C3orf15-shRNA-Seq2)(CAT#: AdV-SI0459WQ)
This product is a C3orf15-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C3orf15-shRNA-Seq2 |
| Related Target/Protein | C3orf15 |
| Region | 3UTR |
| TargetSeq | CCTGATTCAAAGACTGTCAAA |
| NCBI RefSeq | NM_033364 |
| Alternative Names | AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Kartagener syndrome |
