shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C5orf13-shRNA-Seq2)(CAT#: AdV-SI0457WQ)

This product is a C5orf13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C5orf13-shRNA-Seq2
Related Target/Protein C5orf13
Region CDS
TargetSeq CAAGAACCATTTCCAAACAAG
NCBI RefSeq NM_004772
Alternative Names P311; PTZ17; SEZ17; D4S114; NREP; PRO1873
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 9315
Uniprot ID Q16612

Related Products