shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C7orf64-shRNA-Seq1)(CAT#: AdV-SI0323WQ)

This product is a C7orf64-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C7orf64-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C7orf64-shRNA-Seq1
Related Target/Protein C7orf64
Region CDS
TargetSeq CCTGTGAATTGCCTTTATGTT
NCBI RefSeq NM_032120
Alternative Names RBM48; HSPC304
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84060
Uniprot ID Q5RL73

Related Products