shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C8orf4-shRNA-Seq1)(CAT#: AdV-SI0061WQ)
This product is a C8orf4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C8orf4 gene encodes a small, monomeric, predominantly unstructured protein that functions as a positive regulator of the Wnt/beta-catenin signaling pathway. The expression of C8orf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C8orf4-shRNA-Seq1 |
Related Target/Protein | C8orf4 |
Region | CDS |
TargetSeq | GAGACAAGAAAGCAGAGGAGA |
NCBI RefSeq | NM_020130 |
Alternative Names | TC1; TC-1; TCIM |
Titer | >1*10^10 GC/mL |
Related Diseases | Thyroid cancer, breast cancer and hematological malignancies |