shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Cbwd1-shRNA-Seq5)(CAT#: AdV-SI1955WQ)

This product is a Cbwd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Cbwd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Cbwd1-shRNA-Seq5
Related Target/Protein Cbwd1
Region CDS
TargetSeq CTATGATATTCTCTCTGGAAT
NCBI RefSeq NM_146097
Alternative Names COBP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55871
Uniprot ID Q9BRT8

Related Products