shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CIAPIN1-shRNA-Seq2)(CAT#: AdV-SI0275WQ)
This product is a CIAPIN1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CIAPIN1-shRNA-Seq2 |
| Related Target/Protein | CIAPIN1 |
| Region | 3UTR |
| TargetSeq | GCAGAACTCTGAACGACAATA |
| NCBI RefSeq | NM_020313 |
| Alternative Names | DRE2; CIAE2; PRO0915; Anamorsin |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular Carcinoma |