shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Csn1s2a-shRNA-Seq3)(CAT#: AdV-SI1845WQ)

This product is a Csn1s2a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Csn1s2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Csn1s2a-shRNA-Seq3
Related Target/Protein Csn1s2a
Region CDS
TargetSeq GCGTGTTCTTCCAAACAACTA
NCBI RefSeq NM_007785
Alternative Names CSN1S2AP; CSN1S2A
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286828
Uniprot ID Q8IUJ1

Related Products