shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Cyb5d2-shRNA-Seq4)(CAT#: AdV-SI2039WQ)
This product is a Cyb5d2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Cyb5d2-shRNA-Seq4 |
Related Target/Protein | Cyb5d2 |
Region | CDS |
TargetSeq | CGCAGAAAGCAATACTTGGTA |
NCBI RefSeq | XM_109819 |
Alternative Names | CYB5D2 |
Titer | >1*10^10 GC/mL |