shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DHX8-shRNA-Seq2)(CAT#: AdV-SI0026WQ)
This product is a DHX8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DHX8 gene contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus.The expression of DHX8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | DHX8-shRNA-Seq2 |
Related Target/Protein | DHX8 |
Region | CDS |
TargetSeq | AGACAGAGATAGGGAACGAAA |
NCBI RefSeq | NM_004941 |
Alternative Names | DDX8; Dhr2; HRH1; PRP22; PRPF22 |
Titer | >1*10^10 GC/mL |
Related Diseases | HIV infection |