shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DKFZp434P055-shRNA-Seq2)(CAT#: AdV-SI0328WQ)

This product is a DKFZp434P055-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of DKFZp434P055-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert DKFZp434P055-shRNA-Seq2
Related Target/Protein DKFZp434P055
Region CDS
TargetSeq GCAAACAAAGCTAGATCACAT
NCBI RefSeq NM_173466
Titer >1*10^10 GC/mL

Related Products