shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Fads6-shRNA-Seq1)(CAT#: AdV-SI2318WQ)
This product is a Fads6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. This protein encoded by Fads6 gene is involved in the pathway fatty acid metabolism, which is part of Lipid metabolism.The expression of Fads6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Fads6-shRNA-Seq1 |
| Related Target/Protein | Fads6 |
| Region | CDS |
| TargetSeq | CATGAATGTGTCAGGCTTCAA |
| NCBI RefSeq | NM_178035 |
| Alternative Names | FP18279 |
| Titer | >1*10^10 GC/mL |
