shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FAM171A1-shRNA-Seq3)(CAT#: AdV-SI0189WQ)
This product is a FAM171A1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The FAM171A1 gene is involved in the regulation of the cytoskeletal dynamics and plays a role in actin stress fiber formation. The expression of FAM171A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | FAM171A1-shRNA-Seq3 |
Related Target/Protein | FAM171A1 |
Region | 3UTR |
TargetSeq | GCGAGCTGAATGTGACTATTA |
NCBI RefSeq | NM_001010924 |
Alternative Names | APCN; C10orf38 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |