shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FAM36A-shRNA-Seq2)(CAT#: AdV-SI0499WQ)

This product is a FAM36A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert FAM36A-shRNA-Seq2
Related Target/Protein FAM36A
Region CDS
TargetSeq CAAAGCAAAGAATCCAGGAAA
NCBI RefSeq NM_198076
Alternative Names COX20
Titer >1*10^10 GC/mL
Related Diseases Mitochondrial complex IV deficiency
Target Gene
Gene ID 116228
Uniprot ID Q5RI15

Related Products