shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FAM53C-shRNA-Seq2)(CAT#: AdV-SI1522WQ)
This product is a FAM53C-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | FAM53C-shRNA-Seq2 |
Related Target/Protein | FAM53C |
Region | CDS |
TargetSeq | GACTTGAATTTGATTGAGGAA |
NCBI RefSeq | NM_016605 |
Alternative Names | C5orf6 |
Titer | >1*10^10 GC/mL |
Related Diseases | Prostate cancer |