shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FANCI-shRNA-Seq1)(CAT#: AdV-SI0338WQ)

This product is a FANCI-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert FANCI-shRNA-Seq1
Related Target/Protein FANCI
Region CDS
TargetSeq CCCTGTGTTATTCTTTCATTT
NCBI RefSeq NM_018193
Alternative Names KIAA1794
Titer >1*10^10 GC/mL
Related Diseases DNA Damage
Target Gene
Gene ID 55215
Uniprot ID Q9NVI1

Related Products