shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FBXL16-shRNA-Seq2)(CAT#: AdV-SI1514WQ)

This product is a FBXL16-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by FBXL16 belongs to the F-box protein family and they interact with ubiquitination targets through other protein interaction domains. The expression of FBXL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert FBXL16-shRNA-Seq2
Related Target/Protein FBXL16
Region 3UTR
TargetSeq GCTGTTGAATCAGAAACAGAT
NCBI RefSeq NM_153350
Alternative Names Fbl16; C16orf22; c380A1.1
Titer >1*10^10 GC/mL
Related Diseases Ductal Carcinoma
Target Gene
Gene ID 146330
Uniprot ID Q8N461

Related Products