shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Gramd1a-shRNA-Seq1)(CAT#: AdV-SI2214WQ)
This product is a Gramd1a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gramd1a gene is cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER). The expression of Gramd1a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Gramd1a-shRNA-Seq1 |
| Related Target/Protein | Gramd1a |
| Region | CDS |
| TargetSeq | CGAAGATTATTTCCACCACCT |
| NCBI RefSeq | NM_027898 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |