shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Gsdma3-shRNA-Seq1)(CAT#: AdV-SI2329WQ)
This product is a Gsdma3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gsdma3 gene may play a role in the transition from catagen to telogen at the end of hair follicle morphogenesis. The expression of Gsdma3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Gsdma3-shRNA-Seq1 |
| Related Target/Protein | Gsdma3 |
| Region | CDS |
| TargetSeq | GCTCTGACAGAGCTAACTGAA |
| NCBI RefSeq | NM_001007461 |
| Alternative Names | Bsk; Dfl; Fgn; Rco2; Rim3; Gsdm3; Gsdm1l |
| Titer | >1*10^10 GC/mL |