shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(JMJD8-shRNA-Seq1)(CAT#: AdV-SI0153WQ)
This product is a JMJD8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | JMJD8-shRNA-Seq1 |
Related Target/Protein | JMJD8 |
Region | CDS |
TargetSeq | CAATGACACCCTGTACTTCTT |
NCBI RefSeq | NM_001005920 |
Alternative Names | PP14397; C16orf20 |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |