shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KHDRBS1-shRNA-Seq1)(CAT#: AdV-SI0044WQ)
This product is a KHDRBS1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KHDRBS1-shRNA-Seq1 |
Related Target/Protein | KHDRBS1 |
Region | 3UTR |
TargetSeq | GTTCCCAAGTTAGTCAAGTAT |
NCBI RefSeq | NM_006559 |
Alternative Names | p62; p68; Sam68 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ovarian insufficiency |