shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KIAA0495-shRNA-Seq1)(CAT#: AdV-SI0425WQ)

This product is a KIAA0495-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA0495-shRNA-Seq1
Related Target/Protein KIAA0495
Region CDS
TargetSeq CAAGTAAAGATACCAGCAGTG
NCBI RefSeq NM_207306
Alternative Names PDAM; TP73-AS1
Titer >1*10^10 GC/mL
Related Diseases Oligodendroglial tumors
Target Gene
Gene ID 57212
Uniprot ID A0A024R4G0

Related Products