shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KIAA1841-shRNA-Seq2)(CAT#: AdV-SI0219WQ)

This product is a KIAA1841-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA1841-shRNA-Seq2
Related Target/Protein KIAA1841
Region CDS
TargetSeq CCATGCAACATGAACTGTATT
NCBI RefSeq NM_032506
Titer >1*10^10 GC/mL
Related Diseases Lung adenocarcinoma
Target Gene
Gene ID 84542
Uniprot ID Q6NSI8

Related Products