shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LRRC18-shRNA-Seq1)(CAT#: AdV-SI0206WQ)
This product is a LRRC18-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | LRRC18-shRNA-Seq1 |
Related Target/Protein | LRRC18 |
Region | CDS |
TargetSeq | CCGGGACAACCTGAATAGAAT |
NCBI RefSeq | NM_001006939 |
Alternative Names | UNQ933; UNQ9338; VKGE9338 |
Titer | >1*10^10 GC/mL |