shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LSM12-shRNA-Seq2)(CAT#: AdV-SI0474WQ)

This product is a LSM12-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of LSM12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LSM12-shRNA-Seq2
Related Target/Protein LSM12
Region 3UTR
TargetSeq GCTCCTCATTGAGGGATAGTT
NCBI RefSeq NM_152344
Alternative Names PNAS-135
Titer >1*10^10 GC/mL
Related Diseases Oxidative Stress
Target Gene
Gene ID 124801
Uniprot ID Q3MHD2

Related Products