shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Mrpl43-shRNA-Seq1)(CAT#: AdV-SI2222WQ)

This product is a Mrpl43-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Mrpl43 gene help in protein synthesis within the mitochondrion. The expression of Mrpl43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Mrpl43-shRNA-Seq1
Related Target/Protein Mrpl43
Region 3UTR
TargetSeq CAGATGAATCTCTGCGTTTAA
NCBI RefSeq NM_053164
Alternative Names L43mt; MRP-L43; bMRP36a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84545
Uniprot ID Q8N983

Related Products