shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Mrpl53-shRNA-Seq2)(CAT#: AdV-SI1876WQ)

This product is a Mrpl53-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Mrpl53 gene may help in protein synthesis within the mitochondrion. The expression of Mrpl53-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Mrpl53-shRNA-Seq2
Related Target/Protein Mrpl53
Region CDS
TargetSeq CAACCTCAACTGCTCTGTGAT
NCBI RefSeq NM_026744
Alternative Names L53MT
Titer >1*10^10 GC/mL
Target Gene
Gene ID 116540
Uniprot ID Q96EL3

Related Products