shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Mvp-shRNA-Seq1)(CAT#: AdV-SI2330WQ)

This product is a Mvp-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mvp gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The expression of Mvp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Mvp-shRNA-Seq1
Related Target/Protein Mvp
Region CDS
TargetSeq GTGGAAGTCGTGGAGATCATT
NCBI RefSeq NM_080638
Alternative Names LRP; VAULT1
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 9961
Uniprot ID Q14764

Related Products