shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(NCRNA00085-shRNA-Seq1)(CAT#: AdV-SI0109WQ)
This product is a NCRNA00085-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | NCRNA00085-shRNA-Seq1 |
Related Target/Protein | NCRNA00085 |
Region | CDS |
TargetSeq | CGCATCTGCCAGATGTTTGTT |
NCBI RefSeq | NM_207324 |
Alternative Names | LET7EH; SPACA6P; LINC00085; SPACA6 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |