shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(NCRNA00207-shRNA-Seq2)(CAT#: AdV-SI0330WQ)
This product is a NCRNA00207-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of NCRNA00207-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | NCRNA00207-shRNA-Seq2 |
Related Target/Protein | NCRNA00207 |
Region | CDS |
TargetSeq | CAGAATCAGATGAAGACTCCT |
NCBI RefSeq | NM_001012986 |
Alternative Names | LINC00207 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 388910 |