shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Nudcd1-shRNA-Seq2)(CAT#: AdV-SI1850WQ)
This product is a Nudcd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Nudcd1-shRNA-Seq2 |
Related Target/Protein | Nudcd1 |
Region | CDS |
TargetSeq | CCTAATGGAAATGGTCTAATG |
NCBI RefSeq | NM_026149 |
Alternative Names | CML66; OVA66 |
Titer | >1*10^10 GC/mL |
Related Diseases | Solid tumors |