shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Ola1-shRNA-Seq1)(CAT#: AdV-SI1735WQ)
This product is a Ola1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Ola1-shRNA-Seq1 |
Related Target/Protein | Ola1 |
Region | CDS |
TargetSeq | CAATGGTCTACTTGGTGAATC |
NCBI RefSeq | NM_025942 |
Alternative Names | DOC45; GBP45; GTBP9; GTPBP9; PTD004 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |