shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR52I1-shRNA-Seq6)(CAT#: AdV-SI1668WQ)

This product is a OR52I1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR52I1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR52I1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR52I1-shRNA-Seq6
Related Target/Protein OR52I1
Region CDS
TargetSeq GATGATGAATCATCTACCTTT
NCBI RefSeq XM_372348
Alternative Names OR11-13
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390037
Uniprot ID Q8NGK6

Related Products