shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PATL1-shRNA-Seq2)(CAT#: AdV-SI0104WQ)

This product is a PATL1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PATL1-shRNA-Seq2
Related Target/Protein PATL1
Region CDS
TargetSeq CCAATGTTTAGACCGGACACA
NCBI RefSeq NM_152716
Alternative Names Pat1b; hPat1b
Titer >1*10^10 GC/mL
Related Diseases Hepatitis C virus (HCV) infection
Target Gene
Gene ID 219988
Uniprot ID Q86TB9

Related Products