shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PLEKHM1-shRNA-Seq1)(CAT#: AdV-SI0430WQ)
This product is a PLEKHM1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PLEKHM1 gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. The expression of PLEKHM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PLEKHM1-shRNA-Seq1 |
Related Target/Protein | PLEKHM1 |
Region | 3UTR |
TargetSeq | GCCAGTGCTTTCAGATGCATT |
NCBI RefSeq | NM_014798 |
Alternative Names | B2; AP162; OPTA3; OPTB6 |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive osteopetrosis type 6 (OPTB6) |