shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PRPF18-shRNA-Seq4)(CAT#: AdV-SI0024WQ)

This product is a PRPF18-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PRPF18 gene is found to be essential for the catalytic step II in pre-mRNA splicing process. Mutations in this gene result in RNA synthesis dysfunction.The expression of PRPF18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PRPF18-shRNA-Seq4
Related Target/Protein PRPF18
Region CDS
TargetSeq GAATACGTGAAGGCAAATGAT
NCBI RefSeq NM_003675
Alternative Names PRP18; hPrp18
Titer >1*10^10 GC/mL
Related Diseases late-onset Alzheimer disease (LOAD)
Target Gene
Gene ID 8559
Uniprot ID Q99633

Related Products