shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PRRC1-shRNA-Seq3)(CAT#: AdV-SI0180WQ)
This product is a PRRC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. PRRC1 Belongs to the PRRC1 family. 5 isoforms of the human protein are produced by alternative splicing. The expression of PRRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PRRC1-shRNA-Seq3 |
| Related Target/Protein | PRRC1 |
| Region | CDS |
| TargetSeq | GCACATGGCATTTACTGGGAT |
| NCBI RefSeq | NM_130809 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Head and neck cancer |