shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Psme4-shRNA-Seq1)(CAT#: AdV-SI1721WQ)

This product is a Psme4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Psme4 gene is associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during spermatogenesis and DNA damage response. The expression of Psme4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Psme4-shRNA-Seq1
Related Target/Protein Psme4
Region CDS
TargetSeq GCGTTGGCTGAACAAGTTAAT
NCBI RefSeq NM_134013
Alternative Names PA200
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 23198
Uniprot ID Q14997

Related Products