shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Rtn4ip1-shRNA-Seq1)(CAT#: AdV-SI2252WQ)
This product is a Rtn4ip1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Rtn4ip1 gene encodes a mitochondrial protein that interacts with reticulon 4, which is a potent inhibitor of regeneration following spinal cord injury. The expression of Rtn4ip1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Rtn4ip1-shRNA-Seq1 |
| Related Target/Protein | Rtn4ip1 |
| Region | CDS |
| TargetSeq | GAACATGATGTTACCTATCAT |
| NCBI RefSeq | NM_130892 |
| Alternative Names | NIMP; OPA10 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Optic atrophy |
